D3Mit130 Primer Detail MGI Mouse MGI:704664

D3Mit130 Primer Detail

Name

D3Mit130
Primer 1 Sequence

AACACATGAAACGTGTGCGT
Primer 2 Sequence

TGATAGGCATGCTTAAGCCC
ID

MGI:704664
Product Size

125
Other IDs

D3Mit130 (BROAD)
Note

MIT assay: D1218
Additional information: MIT STS Marker Data Files

D3Mit130

DNA segment, Chr 3, Massachusetts Institute of Technology 130

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit130	a	113bp	AKR/J
	b	121bp	A/J, BALB/cJ, C3H/HeJ
	c	131bp	SPRET/EiJ
	d	137bp	LP/J, NON/ShiLt
	e	149bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	f	161bp	DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D3Mit130	a	138bp	AKR/OlaHsd, SJL/J
	b	126bp	C57BL/6JOlaHsd, C57BL/10
	d	124bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, JF1
	g	130bp	129P3/J
	p	136bp	PWB

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit130	a	larger	129P3/J
	D3Mit130	s	smaller	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D3Mit130	a	149bp	129/SvW, AKR/W, BN/aW, CBA/W
	b	130bp	A.CA/W, C3H/W, C57BL/6W, C57BL/10W, DBA/2W
	c	121bp	BALB/cW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23