D15Mit154 Primer Detail MGI Mouse MGI:704528

D15Mit154 Primer Detail

Name

D15Mit154
Primer 1 Sequence

AGCACTGGGTACACAAACTGG
Primer 2 Sequence

ATGAAAGCATGTGTAGTCTTTCTCA
ID

MGI:704528
Product Size

150
Other IDs

D15Mit154 (BROAD)
Note

MIT assay: MT2211
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 154

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit154	b	larger	C57BL/6J
	D15Mit154	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit154	a	153bp	SPRET/EiJ
	b	165bp	AKR/J, NON/ShiLt
	c	169bp	C3H/HeJ, LP/J
	d	179bp	CAST/EiJ, DBA/2J, NOD/MrkTac
	e	190bp	B6.Cg-Lep^ob/+
	f	193bp	A/J, C57BL/6J
	g	198bp	BALB/cJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23