D12Mit12 Primer Detail MGI Mouse MGI:704108

D12Mit12 Primer Detail

Name

D12Mit12
Primer 1 Sequence

TTCAATGCCTTCTGGCTTCT
Primer 2 Sequence

GATTACCGGGTGTGTGACCT
ID

MGI:704108
Product Size

145
Other IDs

D12Mit12 (BROAD)
Note

MIT assay: B269
Additional information: MIT STS Marker Data Files

D12Mit12

DNA segment, Chr 12, Massachusetts Institute of Technology 12

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D12Mit12	b	smallest	C57BL/6J
	c	164bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit12	a	146bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	152bp	CAST/EiJ
	c	156bp	AKR/J, DBA/2J, LP/J, NON/ShiLt
	d	164bp	C3H/HeJ
	e	166bp	SPRET/EiJ
	f	170bp	A/J, BALB/cJ, NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit12	b	144bp	C57BL/6JOlaHsd
	c	170bp	A/JOlaHsd, BALB/cJ
	d	154bp	129P3/J, AKR/OlaHsd, C57BL/10, DBA/2J, SJL/J
	h	162bp	C3H/HeJ
	j	150bp	JF1
	p	160bp	PWB

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit12	l	larger	LG/J
	D12Mit12	s	samller	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23