D19Mit59 Primer Detail MGI Mouse MGI:703544

D19Mit59 Primer Detail

Name

D19Mit59
Primer 1 Sequence

CTCTAACTATCCTCTGACCTTCACA
Primer 2 Sequence

TTTTAAGCAGAACATTGAGGACC
ID

MGI:703544
Product Size

199
Other IDs

D19Mit59 (BROAD)
Note

MIT assay: MT1239
Additional information: MIT STS Marker Data Files

D19Mit59

DNA segment, Chr 19, Massachusetts Institute of Technology 59

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit59	a	139bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
	b	199bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	c	201bp	CAST/EiJ, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit59	a	199bp	129/SvW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D19Mit59	b	139bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit59	c	smaller	CBA/Kw
	D19Mit59	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23