D9Mit81 Primer Detail MGI Mouse MGI:703518

D9Mit81 Primer Detail

Name

D9Mit81
Primer 1 Sequence

TGGTGTGTGGTTTTTGAAATG
Primer 2 Sequence

CCTGTGGAAGAAGTGGGAAA
ID

MGI:703518
Product Size

165
Other IDs

D9Mit81 (BROAD)
Note

MIT assay: MPC1509
Additional information: MIT STS Marker Data Files

D9Mit81

DNA segment, Chr 9, Massachusetts Institute of Technology 81

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit81	a	168bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	b	170bp	SPRET/EiJ
	c	176bp	CAST/EiJ
	d	178bp	NON/ShiLt
	e	182bp	A/J, BALB/cJ, C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit81	a	182bp	A.CA/W, BALB/cW, C3H/W
	D9Mit81	b	168bp	129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23