About   Help   FAQ
D9Mit82 Primer Detail
Primers
  • Name
    D9Mit82
  • Primer 1 Sequence
    GCGGCAGTAGGACATTGTTT
  • Primer 2 Sequence
    CCTGAGCACTGAAAAGGAATT
  • ID
    MGI:703356
  • Product Size
    151
  • Other IDs
    D9Mit82 (BROAD)
  • Note
    MIT assay: MPC433
    Additional information: MIT STS Marker Data Files
Genes
D9Mit82 DNA segment, Chr 9, Massachusetts Institute of Technology 82
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit82 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit82 a 148bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 150bp CAST/EiJ
c 156bp A/J, BALB/cJ, C3H/HeJ
d 158bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D9Mit82 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit82 c 164bp CBA/CaOlaHsd
s 157bp SWR/OlaHsd
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D9Mit82 c lower CBA/Kw
e upper KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/30/2024
MGI 6.23 		The Jackson Laboratory