About   Help   FAQ
D19Mit14 Primer Detail
Primers
  • Name
    D19Mit14
  • Primer 1 Sequence
    CAAGACCCCAATTTACCCCT
  • Primer 2 Sequence
    ATTGCATTGAACTGATGTTTTTG
  • ID
    MGI:703135
  • Product Size
    149
  • Other IDs
    D19Mit14 (BROAD)
  • Note
    MIT assay: A637
    Additional information: MIT STS Marker Data Files
Genes
D19Mit14 DNA segment, Chr 19, Massachusetts Institute of Technology 14
Polymorphisms
J:45418 Hansen GM, et al., Mamm Genome. 1998 Jan;9(1):88-90
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit14 l 0.14kb SB/LeJ
s 0.115kb M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit14 a 114bp SPRET/EiJ
b 144bp AKR/J, BALB/cJ, LP/J
c 148bp A/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
d 150bp B6.Cg-Lepob/+, C57BL/6J
e 174bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D19Mit14 l larger LG/J
s smaller SM/J
References
J:45418 Hansen GM, et al., Pten, a candidate tumor suppressor gene, maps to mouse chromosome 19. Mamm Genome. 1998 Jan;9(1):88-90
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/16/2024
MGI 6.23 		The Jackson Laboratory