D19Mit17 Primer Detail MGI Mouse MGI:703132

D19Mit17 Primer Detail

Name

D19Mit17
Primer 1 Sequence

GCCCACCTTTATATAGAAACATGC
Primer 2 Sequence

TAAAACATGAGGCAAGCTTAAGC
ID

MGI:703132
Product Size

140
Other IDs

D19Mit17 (BROAD)
Note

MIT assay: B240
Additional information: MIT STS Marker Data Files

D19Mit17

DNA segment, Chr 19, Massachusetts Institute of Technology 17

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit17	m	109bp	MOLF/EiJ
Not Specified	D19Mit17	s	151bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit17	a	100bp	CAST/EiJ
	b	128bp	SPRET/EiJ
	c	132bp	C3H/HeJ
	d	138bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J
	e	140bp	AKR/J, NOD/MrkTac, NON/ShiLt

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23