D17Mit24 Primer Detail MGI Mouse MGI:702813

D17Mit24 Primer Detail

Name

D17Mit24
Primer 1 Sequence

ACCTCTCACCTCTCTCTGTG
Primer 2 Sequence

TGGAGAGACGTCCTATGATG
ID

MGI:702813
Product Size

131
Other IDs

D17Mit24 (BROAD)
Note

MIT assay: D12
Additional information: MIT STS Marker Data Files

D17Mit24

DNA segment, Chr 17, Massachusetts Institute of Technology 24

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit24	a	smallest	M. spretus, P/J
		b	larger	DBA/2J
		c	larger than above	CAST/EiJ
		d	larger than above	A.CA-H2^f/Sn
		e	larger than above	CBA/J
		f	larger than above	C57BL/6J, SM/J, SWR/J
		g	larger than above	RIIIS/J
		h	larger than above	SJL/J
		i	larger than above	M. caroli

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit24	b	142bp	C57BL/6J
Not Specified	D17Mit24	s	126bp	129X1/SvJ, BALB/cJ

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit24	m	144bp	MOLF/EiJ
Not Specified	D17Mit24	s	160bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit24	a	117bp	SPRET/EiJ
	b	126bp	BALB/cJ, DBA/2J, LP/J
	c	137bp	CAST/EiJ
	d	142bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	e	144bp	AKR/J, C3H/HeJ

J:66472 Matsune K, J Oral Sci. 2000 Mar;42(1):21-6

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit24	b	larger	C57BL/6J
	D17Mit24	l	smaller	C57L/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit24	l	larger	LG/J
	D17Mit24	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit24	a	142bp	AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	b	130bp	A.CA/W
	c	126bp	129/SvW, BALB/cW, BN/aW, DBA/2W

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:66472 Matsune K, Molecular genetic study of the gutter shaped root (GSR) on mouse chromosome 17. J Oral Sci. 2000 Mar;42(1):21-6

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23