D11Mit271 Primer Detail MGI Mouse MGI:702780

D11Mit271 Primer Detail

Name

D11Mit271
Primer 1 Sequence

TCTCCACACATTCACCATGG
Primer 2 Sequence

CTTCCTCAATTGCTCTTGCC
ID

MGI:702780
Product Size

120
Other IDs

D11Mit271 (BROAD)
Note

MIT assay: MT4388
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 271

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit271	a	116bp	129X1/Sv
Not Specified	D11Mit271	f	118bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit271	a	106bp	SPRET/EiJ
	b	116bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	c	120bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt
	d	123bp	AKR/J, NOD/MrkTac
	e	134bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D11Mit271	a	123bp	AKR/OlaHsd, SJL/J
	c	115bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, JF1
	d	121bp	C57BL/6JOlaHsd, DBA/2J
	p	117bp	PWB
	r	119bp	C57BL/10

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23