D4Mit42 Primer Detail MGI Mouse MGI:702438

D4Mit42 Primer Detail

Name

D4Mit42
Primer 1 Sequence

CATGTTTGCCACCCTGAAAC
Primer 2 Sequence

CCTCACTTAGGCAGGTGACTC
ID

MGI:702438
Product Size

100
Other IDs

D4Mit42 (BROAD)
Note

MIT assay: J5
Additional information: MIT STS Marker Data Files

D4Mit42

DNA segment, Chr 4, Massachusetts Institute of Technology 42

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit42	b	larger	C57BL/6J
	D4Mit42	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit42	a	88bp	SPRET/EiJ
	b	91bp	DBA/2J
	c	94bp	C3H/HeJ, LP/J
	d	98bp	AKR/J, NOD/MrkTac, NON/ShiLt
	e	102bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	f	118bp	CAST/EiJ

J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit42	a	bigger	C57BL/6ByJ
	D4Mit42	b	smaller	129P3/J

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit42	a	larger	129P3/J
	D4Mit42	s	smaller	SJL/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23