About   Help   FAQ
D10Mit133 Primer Detail
Primers
  • Name
    D10Mit133
  • Primer 1 Sequence
    AGCCACTCTAACATAACTCCTGTG
  • Primer 2 Sequence
    TCCACAATGCTGATTTGTAAGG
  • ID
    MGI:702421
  • Product Size
    138
  • Other IDs
    D10Mit133 (BROAD)
  • Note
    MIT assay: MT1195
    Additional information: MIT STS Marker Data Files
Genes
D10Mit133 DNA segment, Chr 10, Massachusetts Institute of Technology 133
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit133 a 123bp BALB/cJ, DBA/2J
b 125bp A/J
c 135bp CAST/EiJ, SPRET/EiJ
d 141bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
e 143bp B6.Cg-Lepob/+, C57BL/6J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit133 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/30/2024
MGI 6.23 		The Jackson Laboratory