About   Help   FAQ
D12Mit99 Primer Detail
Primers
  • Name
    D12Mit99
  • Primer 1 Sequence
    CTTACAGAAAATGAAAACCAAAACA
  • Primer 2 Sequence
    CCTCTGCTTTAGAGGCAAACG
  • ID
    MGI:702324
  • Product Size
    151
  • Other IDs
    D12Mit99 (BROAD)
  • Note
    MIT assay: MPC2219
    Additional information: MIT STS Marker Data Files
Genes
D12Mit99 DNA segment, Chr 12, Massachusetts Institute of Technology 99
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit99 a 173bp 129X1/Sv
f 151bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit99 a 147bp SPRET/EiJ
b 151bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 153bp CAST/EiJ
d 173bp AKR/J, BALB/cJ, DBA/2J, LP/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/16/2024
MGI 6.23 		The Jackson Laboratory