D6Mit9 Primer Detail MGI Mouse MGI:702215

D6Mit9 Primer Detail

Name

D6Mit9
Primer 1 Sequence

GTCTGTTTTGGCATATGGCA
Primer 2 Sequence

TCTGGGTANCCAACCATGTT
ID

MGI:702215
Product Size

137
Other IDs

D6Mit9 (BROAD)
Note

MIT assay: L23
Additional information: MIT STS Marker Data Files

D6Mit9

DNA segment, Chr 6, Massachusetts Institute of Technology 9

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit9	a	largest	C57BL/6, JF1, MSM/Ms
Not Specified	D6Mit9	b	smaller	DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit9	a	119bp	A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	130bp	CAST/EiJ
	c	141bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	d	149bp	SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit9	l	larger	LG/J
	D6Mit9	s	smaller	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23