D11Mit205 Primer Detail MGI Mouse MGI:701421

D11Mit205 Primer Detail

Name

D11Mit205
Primer 1 Sequence

GGCAGAGTCTAGTCTGATATCTTGG
Primer 2 Sequence

CAGTGCACAGCCAGGTTG
ID

MGI:701421
Product Size

104
Other IDs

D11Mit205 (BROAD)
Note

MIT assay: MT2221
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 205

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit205	a	100bp	129X1/Sv
Not Specified	D11Mit205	f	100, 106bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit205	a	95bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	100bp	A/J, C3H/HeJ, DBA/2J
	c	104bp	AKR/J
	d	106bp	BALB/cJ, LP/J, NON/ShiLt
	e	115bp	SPRET/EiJ
	f	127bp	NOD/MrkTac
	g	133bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23