D10Mit8 Primer Detail MGI Mouse MGI:701268

D10Mit8 Primer Detail

Name

D10Mit8
Primer 1 Sequence

AGTGTTAGTGGCTGGGGTG
Primer 2 Sequence

TGAACGTTTCAGTTGGTCCA
ID

MGI:701268
Product Size

201
Other IDs

D10Mit8 (BROAD)
Note

MIT assay: M3
Additional information: MIT STS Marker Data Files

D10Mit8

DNA segment, Chr 10, Massachusetts Institute of Technology 8

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit8	a	largest	JF1, MSM/Ms
Not Specified	D10Mit8	b	smaller	C57BL/6, DBA/2

J:45743 Zobeley E, et al., Genomics. 1998 Jun 1;50(2):260-6

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit8	b	201bp	C57BL/6J
Not Specified	D10Mit8	c	188bp	CASA/RkJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit8	a	188bp	CAST/EiJ
	b	201bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	206bp	LP/J
	d	208bp	B6.Cg-Lep^ob/+
	e	215bp	SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:45743 Zobeley E, et al., Fine genetic and comparative mapping of the deafness mutation Ames waltzer on mouse chromosome 10. Genomics. 1998 Jun 1;50(2):260-6

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23