D17Mit105 Primer Detail MGI Mouse MGI:701146

D17Mit105 Primer Detail

Name

D17Mit105
Primer 1 Sequence

CCCTATAGCCTTTATCTGGGG
Primer 2 Sequence

TGTACAACCTCTTGGGGCTC
ID

MGI:701146
Product Size

115
Other IDs

D17Mit105 (BROAD)
Note

MIT assay: MT620
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 105

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit105	a	smallest	STOCK t^w12
		b	larger	STOCK t^w5
		c	largest	C3H
		d	large	STOCK t¹²

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit105	a	small	C3.SW-H2^b, C57BL/6, C57BL/10
		b	medium	C3H/HeJ
		c	large	B10.CAS3

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit105	a	smallest	CAST/EiJ, RIIIS/J
		b	larger	C57BL/6J, DBA/2J, SJL/J, SM/J, SWR/J
		c	larger than above	CBA/J, P/J
		d	larger than above	M. spretus
		e	larger than above	A.CA-H2^f/Sn
		f	larger than above	M. caroli

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit105	a	103bp	CAST/EiJ
	b	117bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, NON/ShiLt
	c	119bp	A/J, LP/J
	d	121bp	AKR/J, C3H/HeJ
	e	129bp	NOD/MrkTac

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23