D17Mit104 Primer Detail MGI Mouse MGI:701145

D17Mit104 Primer Detail

Name

D17Mit104
Primer 1 Sequence

GGACATGATCACCACCTACTCA
Primer 2 Sequence

ATGAATGGAAATCTGCAATGG
ID

MGI:701145
Product Size

110
Other IDs

D17Mit104 (BROAD)
Note

MIT assay: MT859
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 104

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit104	a	larger	STOCK t¹², STOCK t^w5
		b	smallest	STOCK t^w12
		c	large	C3H

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit104	a	small	C3.SW-H2^b
		b	medium	C3H/HeJ
		c	large	C57BL/6, C57BL/10
		d	larger	B10.CAS4

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit104	a	100bp	LP/J
	b	106bp	AKR/J, C3H/HeJ
	c	108bp	CAST/EiJ
	d	112bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	114bp	A/J, NOD/MrkTac, NON/ShiLt

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23