D17Mit106 Primer Detail MGI Mouse MGI:701143

D17Mit106 Primer Detail

Name

D17Mit106
Primer 1 Sequence

CAGGCAAGACTGGGGATTTT
Primer 2 Sequence

GCTAGCAGTGAGCATCAGTCA
ID

MGI:701143
Product Size

149
Other IDs

D17Mit106 (BROAD)
Note

MIT assay: MMH363
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 106

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D17Mit106	b	larger than f	C57BL/6J
	c	147bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit106	a	133bp	CAST/EiJ, LP/J
	b	147bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	149bp	SPRET/EiJ
	d	151bp	NOD/MrkTac
	e	153bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23