D7Mit62 Primer Detail MGI Mouse MGI:700352

D7Mit62 Primer Detail

Name

D7Mit62
Primer 1 Sequence

CACTGTATGCAAAATTCTCAAAGA
Primer 2 Sequence

TAGGATGACCTCTATATGTCTGCC
ID

MGI:700352
Product Size

147
Other IDs

D7Mit62 (BROAD)
Note

MIT assay: B671
Additional information: MIT STS Marker Data Files

D7Mit62

DNA segment, Chr 7, Massachusetts Institute of Technology 62

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit62	a	134bp	AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
	b	136bp	A/J
	c	148bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	158bp	C3H/HeJ, DBA/2J, LP/J, SPRET/EiJ
	e	164bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit62	l	larger	LG/J
	D7Mit62	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Mit62	a	158bp	C3H/W, DBA/2W
	b	148bp	129/SvW, C57BL/6W, C57BL/10W, CBA/W
	c	134bp	A.CA/W, AKR/W, BALB/cW, BN/aW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23