D11Mit34 Primer Detail MGI Mouse MGI:700269

D11Mit34 Primer Detail

Name

D11Mit34
Primer 1 Sequence

CGCCAGCCAGGAATACTTAG
Primer 2 Sequence

AGTAAAATGAGCCCTTTCCTCC
ID

MGI:700269
Product Size

149
Other IDs

D11Mit34 (BROAD)
Note

MIT assay: A1113
Additional information: MIT STS Marker Data Files

D11Mit34

DNA segment, Chr 11, Massachusetts Institute of Technology 34

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit34	c	148bp	C3HeB/FeJLe
	D11Mit34	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit34	a	140bp	CAST/EiJ
	b	148bp	AKR/J, BALB/cJ, C3H/HeJ
	c	150bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	d	152bp	DBA/2J
	e	162bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23