Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Apelaem1Zyq
Name:	apelin receptor early endogenous ligand; endonuclease-mediated mutation 1, Qing Zhu
MGI ID:	MGI:6833992
Gene:	Apela  Location: Chr8:65481069-65489970 bp, - strand  Genetic Position: Chr8, 32.52 cM
Alliance:	Apelaem1Zyq page

Strain of Origin:

Not Applicable

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Not Specified   Mutation details: CRISPR-targeting with guides ACCGCACAGACTGGAAATCCTCGG (sense) and AAACCCGAGGATTTCCAGTCTGTG (antisense) generated a null allele. (J:314153)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Apela Mutation:	18 strains or lines available

Original:	J:314153 Chen Z, et al., ELABELA attenuates deoxycorticosterone acetate/salt-induced hypertension and renal injury by inhibition of NADPH oxidase/ROS/NLRP3 inflammasome pathway. Cell Death Dis. 2020 Aug 22;11(8):698
All:	1 reference(s)