Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Cfap53em1Hmd
Name:	cilia and flagella associated protein 53; endonuclease-mediated mutation 1, Hiroshi Hamada
MGI ID:	MGI:6720857
Synonyms:	Cfap53-
Gene:	Cfap53  Location: Chr18:74416171-74493055 bp, + strand  Genetic Position: Chr18, 50.7 cM, cytoband E2
Alliance:	Cfap53em1Hmd page

Strain of Origin:

C57BL/6

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: Exon 2 was targeted with two sgRNAs (targeting CCTCTTAATTTTTACTTATTGTA and GGTGAGCCAAAATATGGGCC) using CRISPR/Cas9 technology, resulting in the deletion of the exon. (J:301033)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cfap53 Mutation:	56 strains or lines available

Original:	J:301033 Ide T, et al., CFAP53 regulates mammalian cilia-type motility patterns through differential localization and recruitment of axonemal dynein components. PLoS Genet. 2020 Dec;16(12):e1009232
All:	1 reference(s)