About   Help   FAQ
Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe
Endonuclease-mediated Allele Detail
Summary
Symbol: Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Jason Heaney
MGI ID: MGI:6508540
Synonyms: Ai9-Cas12a
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe page
Mutation
origin
Strain of Origin:  B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J
Project Collection: CPMM
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsCRISPR/Cas9 editing of Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (Ai9) was modified to duplicate a guide target sequences for A.s. and L.b. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] onto the 3' end of the stop cassette. With this modification, a single guide RNA for A.s. or L.b. Cas12a can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. CRISPR-modification of Ai9 lead to the partial deletion of the loxP site on the 3' end of the stop cassette. It is believed that the remaining sequence is not sufficient for Cre-mediated recombination with the 5' loxP site. (J:302569)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  1098 strains or lines available
Notes
This allele was generated from Gt(ROSA)26Sortm9(CAG-tdTomato)Hze.
References
Original:  J:302569 Heaney J, Direct data submission for Gt(ROSA)26Sor allele from Dr. Heaney. MGI Direct Data Submission. 2021;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory