About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:285868 Kong X, et al., Plac1 (placenta-specific 1) is widely expressed during fetal development and is associated with a lethal form of hydrocephalus. Birth Defects Res A Clin Mol Teratol. 2013 Sep;97(9):571-7
Assay type: RT-PCR
MGI Accession ID: MGI:6404911
Gene symbol: Plac1
Gene name: placental specific protein 1
Probe: Plac1-pC, Plac1-pD
Assay notes: This assay is a quantitative RT-PCR. Taqman probe (TCAAAGGCCCAACTGCGATTGTCCA) was used. Heterozygous mice were females that inherit the null allele from the mother.
Results Image: 5
 Sample Information Bands Other Sample Information
Lane AgeStructure Size Not Specified Amount Genetic BackgroundMutant Allele(s)Sex
Brain WT E15.5 TS23: brain Present 2 µg; total RNA C57BL/6J Not Specified
Brain Het E15.5 TS23: brain Weak (a) 2 µg; total RNA involves: C57BL/6 Plac1tm1(KOMP)Vlcg/Plac1+Female
Heart WT E15.5 TS23: heart Present (b) 2 µg; total RNA C57BL/6J Not Specified
Heart Het E15.5 TS23: heart Weak (a) 2 µg; total RNA involves: C57BL/6 Plac1tm1(KOMP)Vlcg/Plac1+Female
Kidney WT E15.5 TS23: metanephros Present (b) 2 µg; total RNA C57BL/6J Not Specified
Kidney Het E15.5 TS23: metanephros Weak (a) 2 µg; total RNA involves: C57BL/6 Plac1tm1(KOMP)Vlcg/Plac1+Female
Liver WT E15.5 TS23: liver Present 2 µg; total RNA C57BL/6J Not Specified
Liver Het E15.5 TS23: liver Weak (a) 2 µg; total RNA involves: C57BL/6 Plac1tm1(KOMP)Vlcg/Plac1+Female
Lung WT E15.5 TS23: lung Present (b) 2 µg; total RNA C57BL/6J Not Specified
Lung Het E15.5 TS23: lung Weak (a) 2 µg; total RNA involves: C57BL/6 Plac1tm1(KOMP)Vlcg/Plac1+Female
Intestine WT E15.5 TS23: intestine Present 2 µg; total RNA C57BL/6J Not Specified
Intestine Het E15.5 TS23: intestine Weak (a) 2 µg; total RNA involves: C57BL/6 Plac1tm1(KOMP)Vlcg/Plac1+Female
Notes:
(a) Expressed at a much lower level.
(b) Highest expression.
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
03/18/2025
MGI 6.24 		The Jackson Laboratory