Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Vstm4em1Gypk
Name:	V-set and transmembrane domain containing 4; endonuclease-mediated mutation 1, Gladys Y-P Ko
MGI ID:	MGI:6393534
Synonyms:	PLv-
Gene:	Vstm4  Location: Chr14:32578713-32661448 bp, + strand  Genetic Position: Chr14, 19.4 cM
Alliance:	Vstm4em1Gypk page

Strain of Origin:

Not Specified

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: CRISPR/Cas9 technology using gRNA sequences (CTAAAGTAAAATAAGACGAAGG andAACGCTGTTGGCATCTCGGAGG) deleted exon 2. (J:285234)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vstm4 Mutation:	24 strains or lines available

Original:	J:285234 Shi L, et al., Newly Identified Peptide, Peptide Lv, Promotes Pathological Angiogenesis. J Am Heart Assoc. 2019 Nov 19;8(22):e013673
All:	1 reference(s)