About   Help   FAQ
Tg(Foxa2-EGFP)1Jbri
Transgene Detail
Summary
Symbol: Tg(Foxa2-EGFP)1Jbri
Name: transgene insertion, James Briscoe
MGI ID: MGI:6376096
Synonyms: 8GBS-hsp68-eGFP, Tg(GBS-GFP)Jbri
Transgene: Tg(Foxa2-EGFP)1Jbri  Location: unknown  
Alliance: Tg(Foxa2-EGFP)1Jbri page
Transgene
origin
Strain of Origin:  FVB/N
Transgene
description
Transgene Type:    Transgenic (Reporter)
Mutation:    Insertion
 
Mutation detailsEight concatemerized fragments of a FoxA2 enhancer that contains a Gli binding site (GBS; TTATGACGGAGGCTAACAAGCAGGGAACACCCAAGTAGAAGCTGGCTGTC) and hsp68 minimal promoter drivie expression of an EGFP reporter gene. The transgene is flanked by two copies of the chicken beta-globin insulator. The pound symbol (#) is used when no line is specified and/or lines are pooled. (J:181293)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
References
Original:  J:181293 Balaskas N, et al., Gene regulatory logic for reading the Sonic Hedgehog signaling gradient in the vertebrate neural tube. Cell. 2012 Jan 20;148(1-2):273-84
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory