Smarce1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Smarce1em1(IMPC)J |
Name: |
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6363556 |
Gene: |
Smarce1 Location: Chr11:99099873-99121843 bp, - strand Genetic Position: Chr11, 62.92 cM, cytoband D
|
Alliance: |
Smarce1em1(IMPC)J page
|
IMPC: |
Smarce1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAAAAATACTCCTTACA and TTTGAAACTGATTAAGCTAA, which resulted in a 955 bp deletion beginning at Chromosome 11 position 99,219,039 bp and ending after 99,219,993 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261138, ENSMUSE00001305116 (exons 6 and 7) and 651 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 7 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|