Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Plcg2em1Msasn
Name:	phospholipase C, gamma 2; endonuclease-mediated mutation 1, Michael Sasner
MGI ID:	MGI:6316314
Synonyms:	Plcg2P522R, Plcg2R522
Gene:	Plcg2  Location: Chr8:118225030-118361881 bp, + strand  Genetic Position: Chr8, 64.26 cM
Alliance:	Plcg2em1Msasn page

Strain of Origin:

B6(SJL)-Apoetm1.1(APOE*4)Adiuj/J

Allele Type:    Endonuclease-mediated (Humanized sequence) Mutation:    Single point mutation   Mutation details: A C-to-G mutation was engineered in proline codon 522 (CCC) to change it to an arginine codon (CGC) (c.1565C>G, p.P522R) with an sgRNA (targeting CCAAAATGCAGCTCCGTGGG) and an ssODN template (GAGCTGTAATAAGCCCTTTCGGATGCTTGTGGCTCAGGACACTCGCCCCACGGAGCTGCATTTTGGGGAGAAATGGTTCCACA) using CRISPR/Cas9 technology. The mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease and has been associated with protection from Alzheimer's disease. (J:308279)

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Plcg2 Mutation:	74 strains or lines available

Original:	J:308279 Maguire E, et al., PIP2 depletion and altered endocytosis caused by expression of Alzheimer's disease-protective variant PLCgamma2 R522. EMBO J. 2021 Jul 13;:e105603
All:	1 reference(s)