About   Help   FAQ
Cdc5lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdc5lem1(IMPC)J
Name: cell division cycle 5-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6305208
Gene: Cdc5l  Location: Chr17:45702809-45744633 bp, - strand  Genetic Position: Chr17, 22.36 cM
Alliance: Cdc5lem1(IMPC)J page
IMPC: Cdc5l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCTGTCAGTGGTTATTCG and ATTGCTTCCCGTGAATAAAA, which resulted in a 344 bp deletion beginning at Chromosome 17 position 45,425,670 bp and ending after 45,426,141 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389518 (exon 4) and 344 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 104. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdc5l Mutation:  74 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory