Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Faxcem1(IMPC)J
Name:	failed axon connections homolog; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6258582
Gene:	Faxc  Location: Chr4:21931329-21996839 bp, + strand  Genetic Position: Chr4, 9.2 cM
Alliance:	Faxcem1(IMPC)J page
IMPC:	Faxc gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGAGGGCAACAATCCCACA and GTAAACCTAAAAGTACCACC, which resulted in a 490 bp deletion beginning at Chromosome 4 position 21,936,545 bp and ending after 21,937,034 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283152 (exon 2) and 354 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 28 amino acids later. There is a 7 bp insertion [TTTTAAG] at the deletion site. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Faxc Mutation:	23 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)