Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Asap3em1(IMPC)J
Name:	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6200307
Gene:	Asap3  Location: Chr4:135933676-135972527 bp, + strand  Genetic Position: Chr4, 68.34 cM
Alliance:	Asap3em1(IMPC)J page
IMPC:	Asap3 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTGCCCAAAGGGTAGCAG and AGCTGTTGTGAAAGGACCAG, which resulted in a 282 bp deletion beginning at Chromosome 4 position 136,229,360 bp and ending after 136,229,641 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000497964(exon5) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 141 and early truncation 36 amino acids later. (J:188991) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Asap3 Mutation:	44 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	1 reference(s)