Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Slc39a10em1(IMPC)J
Name:	solute carrier family 39 (zinc transporter), member 10; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6162488
Gene:	Slc39a10  Location: Chr1:46846704-46932012 bp, - strand  Genetic Position: Chr1, 24.07 cM
Alliance:	Slc39a10em1(IMPC)J page
IMPC:	Slc39a10 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences GTATGAGTACTACCTTAAAG, ATTTTTTGCATAAATTCCTA, TATTTCCTCTGGCCCTGTAG and TCTGATCCTGTATGAATCTT, which resulted in a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325787 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 338 and early truncation 19 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc39a10 Mutation:	49 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)