Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Vps11em1(IMPC)Rbrc
Name:	VPS11, CORVET/HOPS core subunit; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID:	MGI:6156169
Gene:	Vps11  Location: Chr9:44259046-44272967 bp, - strand  Genetic Position: Chr9, 24.84 cM, cytoband B
Alliance:	Vps11em1(IMPC)Rbrc page
IMPC:	Vps11 gene page

Strain of Origin:	C57BL/6NTac
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences CCATATATAACTGGGTGCAGAGG, GGTTCGGGGCTTGATCCTTCGGG, which resulted in a Exon Deletion. (J:237616)

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vps11 Mutation:	43 strains or lines available

Original:	J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:	3 reference(s)