Pnma2em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
|
Symbol: |
Pnma2em1(IMPC)Rbrc |
Name: |
paraneoplastic antigen MA2; endonuclease-mediated mutation 1, RIKEN BioResource Center |
MGI ID: |
MGI:6156150 |
Gene: |
Pnma2 Location: Chr14:67148619-67158472 bp, + strand Genetic Position: Chr14, 34.6 cM
|
Alliance: |
Pnma2em1(IMPC)Rbrc page
|
IMPC: |
Pnma2 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences CCGGCTACTAGGCAAGATATTCC, ATTGGCCCATTTGACGGGGCAGG, which resulted in a Intra-exdel deletion.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Pnma2 Mutation: |
17 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
1 reference(s) |
|