Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Pnma1em1(IMPC)Rbrc
Name:	paraneoplastic antigen MA1; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID:	MGI:6156149
Gene:	Pnma1  Location: Chr12:84192905-84195263 bp, - strand  Genetic Position: Chr12, 39.07 cM, cytoband D3
Alliance:	Pnma1em1(IMPC)Rbrc page
IMPC:	Pnma1 gene page

Strain of Origin:	C57BL/6NJcl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutations:    Insertion, Intragenic deletion   Mutation details: This allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences TGCCCCAGTGAGCTCTAACAAGG, CCCTGGGTATCAGGGAGTAATCC, which resulted in a Indel. (J:237616)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pnma1 Mutation:	9 strains or lines available

Original:	J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:	2 reference(s)