Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Tnnc1em1(IMPC)J
Name:	troponin C, cardiac/slow skeletal; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5911233
Gene:	Tnnc1  Location: Chr14:30930274-30933671 bp, + strand  Genetic Position: Chr14, 19.09 cM
Alliance:	Tnnc1em1(IMPC)J page
IMPC:	Tnnc1 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCCCTCCTCCCCACACTATA, AATGCTAACTGTTCTCTCTC and TGGCCCAAGCAGAGAGGAGA, which resulted in a 222 bp deletion beginning at Chromosome 14 positive strand position 31,210,481 bp and ending after 31,210,702 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001063990(exon 4) and 107 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp intronic deletion (GAGAAG) 18 bp after the 222 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 67 and early truncation 8 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tnnc1 Mutation:	11 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)