Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Kbtbd2em1Btlr
Name:	kelch repeat and BTB (POZ) domain containing 2; endonuclease-mediated mutation 1, Bruce Beutler
MGI ID:	MGI:5806485
Synonyms:	Kbtbd2-
Gene:	Kbtbd2  Location: Chr6:56754510-56774798 bp, - strand  Genetic Position: Chr6, 27.73 cM
Alliance:	Kbtbd2em1Btlr page

Strain of Origin:

Not Specified

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Not Specified   Mutation details: A knockout allele was created using an sgRNA (targeting CCGCTGATTTGCATAAGGTT) with CRISPR/Cas9 technology. (J:236520)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kbtbd2 Mutation:	49 strains or lines available

Original:	J:236520 Zhang Z, et al., Insulin resistance and diabetes caused by genetic or diet-induced KBTBD2 deficiency in mice. Proc Natl Acad Sci U S A. 2016 Oct 18;113(42):E6418-E6426
All:	3 reference(s)