About   Help   FAQ
Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch
Transgene Detail
Summary
Symbol: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch
Name: transgene insertion 4, Daniel Schuemperli
MGI ID: MGI:5767008
Synonyms: U7-ESE-B
Transgene: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch  Location: unknown  
Alliance: Tg(Rnu7-SMN2*,PGK1-EGFP)4Dasch page
Transgene
origin
Strain of Origin:  C57BL/6J x DBA/2J
Transgene
description
Transgene Type:    Transgenic (Knockdown, Reporter)
Mutation:    Insertion
 
Mutation detailsThe U7-ESE-B splicing correction cassette encodes a tailed antisense oligonucleotide directed to the 3' part of human SMN2 exon 7 and an additional splicing enhancer sequence. To create this cassette, a 570 bp region of the U7 wild-type gene (Rnu7) was obtained containing 341 bp 5' flanking sequence (including the distal and proximal sequence promoter elements [DSE and PSE]), 62 bp U7 snRNA coding region and 167 bp 3' sequence (including the 3' box). The 5'GGA non-complementary "tail" sequence (GGAGGACGGAGGACGGAGGAC), predicted to mimic the exonic splicing enhancer (ESE) sequence of an SF2/ASF/SRSF1 binding site, was introduced. The antisense sequence complementary to the histone downstream element in replication-dependent histone pre-mRNAs was changed to a sequence binding to positions 33-50 in the 3' region (position B [also called B1]) of the weak exon 7 of human SMN2. The Sm binding site (aatttGtCT) was changed to the Sm OPT sequence (aatttTtGG ; corresponding to the consensus sequence found in spliceosomal snRNAs). As a consequence, the resulting snRNA no longer binds the U7-specific Sm-like proteins Lsm10 and Lsm11 but rather the five standard Sm proteins found in spliceosomal snRNPs. These changes in snRNP assembly render the RNA non-functional for histone RNA processing and additionally allow it to accumulate in cell nuclei about 3 times more efficiently. The resulting U7-ESE-B splicing correction cassette was introduced into the third generation (self-inactivating) lentiviral vector pRRL-SIN-cPPT-hPGK-GFP-WPRE. The resulting approximate 4.4 kbp transgene had the U7-ESE-B inserted upstream of the hPGK promoter and in sense orientation with EGFP. Line 4 has 8 copies of the transgene. (J:231141)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
References
Original:  J:231141 Voigt T, et al., Ultrastructural changes in diaphragm neuromuscular junctions in a severe mouse model for Spinal Muscular Atrophy and their prevention by bifunctional U7 snRNA correcting SMN2 splicing. Neuromuscul Disord. 2010 Nov;20(11):744-52
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory