About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:148416 Bocock JP, et al., The PA-TM-RING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis. FEBS J. 2009 Apr;276(7):1860-77
Assay type: RT-PCR
MGI Accession ID: MGI:4829893
Gene symbol: Rnf13
Gene name: ring finger protein 13
Probe: Rnf13-pA, Rnf13-pB
Probe preparation: labelled with FAM
Assay notes: Real-time RT-PCR. The oligonucleotides used in this assay were specifically designed to bind only the full-length transcript. These data are shown in Table 1. (probe: 5' F CCAGCAAGATTTGGTTATAGACTACCAGC Q 3')
Results
 Sample Information Bands Other Sample Information
Lane AgeStructure Size Not Specified Amount Genetic BackgroundMutant Allele(s)Sex
Brain P adult TS28: brain Present (a) Not Specified; total RNA Not Specified Not Specified
Heart P adult TS28: heart Present (b) Not Specified; total RNA Not Specified Not Specified
Kidney P adult TS28: metanephros Present (c) Not Specified; total RNA Not Specified Not Specified
Liver P adult TS28: liver Present (d) Not Specified; total RNA Not Specified Not Specified
Spleen P adult TS28: spleen Present Not Specified; total RNA Not Specified Not Specified
Liver P adult TS28: liver Present Not Specified; total RNA Not Specified Not Specified
E14.5 E14.5 (e) TS22: liver Present Not Specified; total RNA Not Specified Not Specified
E16.5 E16.5 (e) TS24: liver Present Not Specified; total RNA Not Specified Not Specified
Adult P adult TS28: brain Present Not Specified; total RNA Not Specified Not Specified
E14.5 E14.5 (e) TS22: brain Present (f) Not Specified; total RNA Not Specified Not Specified
E16.5 E16.5 (e) TS24: brain Present (f) Not Specified; total RNA Not Specified Not Specified
Notes:
(a) 1.9-fold increase relative to adult spleen
(b) Levels were similar to that seen in adult spleen.
(c) 5.7-fold increase relative to adult spleen
(d) 2.6-fold increase relative to adult spleen
(e) Age of embryo at noon of plug day not specified in reference.
(f) There was a four-fold decrease in embryonic brain compared to adult brain.

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory