About   Help   FAQ
Gene Expression Data
Assay Details
Assay
Reference: J:119377 Basu P, et al., KLF2 is essential for primitive erythropoiesis and regulates the human and murine embryonic beta-like globin genes in vivo. Blood. 2005 Oct 1;106(7):2566-71
Assay type: RT-PCR
MGI Accession ID: MGI:3799452
Gene symbol: Hba-x
Gene name: hemoglobin X, alpha-like embryonic chain in Hba complex
Probe: zeta-globin-pE, zeta-globin-pF
Probe preparation: labelled with other - see notes
Visualized with: Fluorescence
Assay notes: The Taqman probe (TGGATCCGGTCAACTTCAAGCTCCTGT) was labeled with FAM (6-carboxyfluorescein) and TAMRA (6-carboxy-tetramethylrhodamine).
Results Image: 1C
 Sample Information Bands Other Sample Information
Lane AgeStructure Size Not Specified Amount Genetic BackgroundMutant Allele(s)Sex
+/+ E10.5 (a) TS17: yolk sac Present Not Specified; total RNA involves: 129P2/OlaHsd * C57BL/6 * FVB/N * Swiss Not Specified
-/- E10.5 (a) TS17: yolk sac Present (b) Not Specified; total RNA involves: 129P2/OlaHsd * C57BL/6 * FVB/N * Swiss Klf2tm1Ling/Klf2tm1LingNot Specified
Notes:
(a) Age of embryo at noon of plug day not specified in reference.
(b) Expression in this mutant is the same as in wild-type embryos.

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory