T9 Primer Detail MGI Mouse MGI:379

T9 Primer Detail

Name

T9
Primer 1 Sequence

GTAATTGCGTTGACTGTTAAAT
Primer 2 Sequence

AGTGCTGCTCCCAACATTACT
ID

MGI:379

D17Nds2

DNA segment, Chr 17, Nuffield Department of Surgery 2

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D17Nds2	e	110bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NON/ShiLt
	f	105bp	A/J, AKR/J, BALB/cJ, CAST/EiJ, DBA/2J
	j	125bp	NOD/MrkTac
	s	80bp	SPRET/EiJ

J:17312 Cheah YC, et al., Mamm Genome. 1994 Mar;5(3):189-90

Endonuclease	Gene	Allele	Fragments	Strains
	D17Nds2	a	smaller	AKR/J
	D17Nds2	l	larger	C57L/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:17312 Cheah YC, et al., Strain distribution patterns for 50 SSLP markers in the murine AKXL recombinant inbred set. Mamm Genome. 1994 Mar;5(3):189-90

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23