About   Help   FAQ
MH950-pA, MH950-pB Primer Detail
Primers
  • Name
    MH950-pA, MH950-pB
  • Primer 1 Sequence
    AGACCGAGAGAAGTATCTAGAGG
  • Primer 2 Sequence
    AAGAGAAATGTCTGCTGAGGTTTAG
  • ID
    MGI:3724002
  • Synonyms
    Erk3 T7-FW, Erk3 SP6-RV, T50663-pA, T50663-pB
Genes
Mapk6 mitogen-activated protein kinase 6
References
J:94780 Schumacher S, et al., Scaffolding by ERK3 regulates MK5 in development. EMBO J. 2004 Dec 8;23(24):4770-4779
J:122989 Visel A, et al., GenePaint.org: an atlas of gene expression patterns in the mouse embryo. Nucleic Acids Res. 2004 Jan 1;32(Database issue):D552-6
J:180468 Kant S, et al., Characterization of the atypical MAPK ERK4 and its activation of the MAPK-activated protein kinase MK5. J Biol Chem. 2006 Nov 17;281(46):35511-9
J:153498 Diez-Roux G, et al., A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLoS Biol. 2011;9(1):e1000582
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/30/2024
MGI 6.23 		The Jackson Laboratory