Ms10s-primerF,Ms10s-primerR Primer Detail MGI Mouse MGI:2153030

About Help FAQ

Ms10s-primerF,Ms10s-primerR Primer Detail

Name

Ms10s-primerF,Ms10s-primerR
Primer 1 Sequence

TGCACAAATGGGAGTGTCTGA
Primer 2 Sequence

GGGTCTCTTGATGACCTGGAG
ID

MGI:2153030

Ms10s

minisatellite 10s detected by probe MMS10

J:69106 Bois PR, et al., Mamm Genome. 2001 Feb;12(2):104-11

Gene	Allele	Fragments	Strains
Ms10s	a	not given	A/J, AKR, C3H/J, C57BL/6J, CBA/J, FVB/NJ, P/J, SJL/J, SWR/J
	c	not given	BALB/cJ
	d	not given	DBA/2J
	d12	not given	BXD12/TyJ
	d31	not given	BXD31/TyJ
	d9	not given	BXD9/TyJ
	s	not given	SPRET/EiJ

J:69106 Bois PR, et al., Length of uninterrupted repeats determines instability at the unstable mouse expanded simple tandem repeat family MMS10 derived from independent SINE B1 elements. Mamm Genome. 2001 Feb;12(2):104-11

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/30/2024 MGI 6.23