Bmal1^em1Joli
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bmal1^em1Joli
• Name: basic helix-loop-helix ARNT like 1; endonuclease-mediated mutation 1, Jonathan O Lipton
• MGI ID: MGI:7547390
• Synonyms: Bmal1-S42A
• Gene: Bmal1 Location: Chr7:112806672-112913333 bp, + strand Genetic Position: Chr7, 59.17 cM, cytoband F2-F3
• Alliance: Bmal1^em1Joli page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 42 (AGT) in exon 5 (in ENSMUST00000047321) was changed to alanine (GCC) (p.S42A) using an sgRNA (targeting GTGTGGACTGCAATCGCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the affected residue in the encoded peptide unphosphorylatable. (J:342247)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Bmal1 Mutation: 139 strains or lines available

References

• Original: J:342247 Barone I, et al., Synaptic BMAL1 phosphorylation controls circadian hippocampal plasticity. Sci Adv. 2023 Oct 27;9(43):eadj1010
• All: 1 reference(s)