Bmal1em1Joli
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Bmal1em1Joli |
| Name: |
basic helix-loop-helix ARNT like 1; endonuclease-mediated mutation 1, Jonathan O Lipton |
| MGI ID: |
MGI:7547390 |
| Synonyms: |
Bmal1-S42A |
| Gene: |
Bmal1 Location: Chr7:112806672-112913333 bp, + strand Genetic Position: Chr7, 59.17 cM, cytoband F2-F3
|
| Alliance: |
Bmal1em1Joli page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Serine codon 42 (AGT) in exon 5 (in ENSMUST00000047321) was changed to alanine (GCC) (p.S42A) using an sgRNA (targeting GTGTGGACTGCAATCGCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the affected residue in the encoded peptide unphosphorylatable.
(J:342247)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Bmal1 Mutation: |
140 strains or lines available
|
|
| Original: |
J:342247 Barone I, et al., Synaptic BMAL1 phosphorylation controls circadian hippocampal plasticity. Sci Adv. 2023 Oct 27;9(43):eadj1010 |
| All: |
1 reference(s) |
|