About   Help   FAQ
Mouse SNPs
Query Results -- Summary
 Symbol
Name
ID
Efna3
ephrin A3
MGI:106644

7 matching SNPs displayed
Full result set is also available in a tab-delimited format.


Legend
 Results are sorted by chromosome/coordinate value. Chromosome transitions are marked by blank rows.
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
Insertions
rs4224065
MPD | dbSNP | MGI SNP Detail
Chr3:89314170fEfna3 : within coordinates of
Gm34014 : within coordinates of
hsh : within coordinates of
1SNP A AAAAA   GA     A/G 
rs4224066
MPD | dbSNP | MGI SNP Detail
Chr3:89314175fEfna3 : within coordinates of
Gm34014 : within coordinates of
hsh : within coordinates of
1SNP C CCCCC   GC     C/G 
rs4224067
MPD | dbSNP | MGI SNP Detail
Chr3:89314222fEfna3 : within coordinates of
Gm34014 : within coordinates of
hsh : within coordinates of
1SNP G GGGGG   AG     A/G 
rs4224068
MPD | dbSNP | MGI SNP Detail
Chr3:89314337fEfna3 : within coordinates of
Gm34014 : within coordinates of
hsh : within coordinates of
1SNP G GGGGG   AG     A/G 
rs4224069
MPD | dbSNP | MGI SNP Detail
Chr3:89314369fEfna3 : within coordinates of
Gm34014 : within coordinates of
hsh : within coordinates of
1Mixed - ---i-   j-     -/GAGCTGGACCCCAGAGCCAGGC/CAGAGCTGGACCCCAGAGCCAGGi-GAGCTGGACCCCAGAGCCAGGC, j-CAGAGCTGGACCCCAGAGCCAGG
rs4224070
MPD | dbSNP | MGI SNP Detail
Chr3:89314441fEfna3 : within coordinates of
Gm34014 : within coordinates of
hsh : within coordinates of
1SNP A AAAAA   GA     A/G 
rs32935945
MPD | dbSNP | MGI SNP Detail
Chr3:89324766fEfna3 : Locus-Region
hsh : within coordinates of
1SNPAAAAA GAAGA  AAAAAA/G 

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/16/2014
MGI 5.20
The Jackson Laboratory