About   Help   FAQ
Molecular Probes and Clones
Query Results -- Details

Primer: st97_733
Primer 1 sequence: AAAAAAACAACGTAATGGGGG
Primer 2 sequence: GGGTGCACACCAGTGAAAC
Product size: 160
Region covered: First primer covers from base 2884 through 2904 in sequence U09383; second primer covers from 3025 through 3043.
MGI Accession ID: MGI:1205938

Markers (chromosome):
References:

J:46439 Freeman TC, MGI Direct Data Submission 1998;():
Additional Information:

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/16/2014
MGI 5.19
The Jackson Laboratory