---

Nucleotide Probe/Clone: Adamts5 cDNA
Sequence type: cDNA
Species of origin: mouse, laboratory
Strain: Not Specified
Sex: Male
Age: Not Specified
Tissue: testis
Region covered: nucleotides 39 - 757 of NM_011782.1
Vector type: Not Specified
Insert size: 0.718kb
MGI Accession ID: MGI:5000913
Notes: This probe was generated via PCR using the following primer set: TTGTTGCTGCTACTGCTGCT and GATGGCGAGAAAGCTGAGTG.

---

Markers (chromosome):

• Adamts5 (Chr16:85858170-85901125 bp)

---

References:

J:171409 GUDMAP: the GenitoUrinary Development Molecular Anatomy Proj, http://www.gudmap.org 2004;():

• Aliases:: maprobe:4169, GUDMAP:6946 probe
  

---

Additional Information:

• Gene Expression Data (1 result in 1 assay)