About   Help   FAQ
Molecular Probes and Clones
Query Results -- Details

Primer: Whrn-pA, Whrn-pB
Primer 1 sequence: GGTCCGTGTGAGGAAAAGTG
Primer 2 sequence: GATAGGCTGGGAGTGCAAAG
MGI Accession ID: MGI:3653111

Markers (chromosome):
References:

J:106765 van Wijk E, Hum Mol Genet 2006 Mar 1;15(5):751-65

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/08/2014
MGI 5.20
The Jackson Laboratory