---

Nucleotide Probe/Clone: MTF#851
Sequence type: cDNA
Species of origin: mouse, laboratory
Strain: C57BL
Sex: Not Specified
Age: embryonic day 13.5
Tissue: brain
Vector type: Plasmid
Insert size: 0.741kb
MGI Accession ID: MGI:3506487
Notes: Fragment was generated by PCR with primers GTTTCTGGCTCAGCTCACAAGG and CACATTCCTTGCACTGATAGGG .

---

Markers (chromosome):

• 1700049G17Rik (Chr7:27907392-27929460 bp)
• Zfp780b (Chr7:27962708-27975368 bp)

---

References:

J:91257 Gray PA, Science 2004 Dec 24;306(5705):2255-2257

J:171409 GUDMAP: the GenitoUrinary Development Molecular Anatomy Proj, http://www.gudmap.org 2004;():

• Aliases:: GUDMAP:9405 probe
  

---

Additional Information:

• Gene Expression Data (88 results in 6 assays)